Skip Navigation

Cardiovascular Research 2007 74(1):140-150; doi:10.1016/j.cardiores.2007.01.010
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Chintalgattu, V.
Right arrow Articles by Katwa, L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chintalgattu, V.
Right arrow Articles by Katwa, L. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2007, European Society of Cardiology

PPAR-{gamma} agonists induce the expression of VEGF and its receptors in cultured cardiac myofibroblasts

Vishnu Chintalgattua, Gregory S. Harrisa, Shaw M. Akulab and Laxmansa C. Katwaa,*

aDepartment of Physiology, The Brody School of Medicine, East Carolina University Greenville, NC USA
bDepartments of Microbiology and Immunology, The Brody School of Medicine, East Carolina University Greenville, NC USA

* Corresponding author. Department of Physiology, Rm. 6E-73C Brody School of Medicine, 600 Moye Blvd. Greenville, NC 27834 USA. Tel.: +1 252 744 1906; fax: +1 252 744 3460. Email address: KatwaL{at}ecu.edu

Received 21 July 2006; revised 18 December 2006; accepted 4 January 2007


    Abstract
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Statistical analysis
 4. Results
 5. Discussion
 Acknowledgments
 References
 
Objectives: Myofibroblasts (myoFb) are the major cell types that appear at the site of myocardial infarction (MI) in response to injury and play a vital role in tissue repair/remodeling. Since vascular endothelial growth factor (VEGF) plays a crucial role in the infarcted/ischemic heart, we hypothesized that activation of the peroxisome proliferator-activated receptor (PPAR)-{gamma} by its agonists induces VEGF expression while simultaneously decreasing inflammation (NF-{kappa}B). Such an increase in myoFb VEGF expression by PPAR-{gamma} agonists may play a role in angiogenesis.

Methods: Rat myoFb were treated with PPAR-{gamma} agonists and VEGF expression was measured by ELISA. The effect of these agonists on VEGF receptors was determined by qRT-PCR and flow-cytometric analysis. VEGF produced by these cells was also used for analysis of in vitro tubule formation (Matrigel assay).

Results: The PPAR-{gamma} activators troglitazone (TZ) and 15-deoxy-prostaglandin J2 (15J2) induced the expression of VEGF and its receptors (Flt-1 and KDR) in myoFb. TZ and 15J2 elicited a significant increase in the expression of KDR (14.7±1.0% and 9.6±2.1% respectively) and Flt-1 (24.5±2.0%, and 14.0±2.2% respectively) when compared to untreated myoFb. MyoFb treated with PPAR-{gamma} agonists increased extracellular VEGF, augmenting tubule formation on a Matrigel. The PPAR-{gamma} activator 15J2 significantly decreased the NF-{kappa}B activity in myoFb.

Conclusion: This study demonstrates the induction of the VEGF accompanied by a reduction of NF-{kappa}B activity (inflammatory signaling) by PPAR-{gamma} agonists in cardiac myoFb. These results may further the understanding of the beneficial effects of PPAR-{gamma} agonists on infarcted tissue repair and angiogenesis.

KEYWORDS Cardiac myofibroblasts; VEGF; PPAR-{gamma} agonists; Myocardial infarction


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Statistical analysis
 4. Results
 5. Discussion
 Acknowledgments
 References
 
Myofibroblasts (myoFbs) appear in response to injury and are widely recognized as a critical cell type involved with wound healing and tissue repair in heart tissue. These cells, isolated from the site of myocardial infarction (MI), have morphological features of both fibroblasts (vimentin positive) and smooth muscle cells ({alpha}- smooth muscle actin positive) [1–4]. Studies from our group demonstrated that the myoFbs isolated from the site of MI are known to produce various pro-remodeling cytokines (angiotensin II, endothelin-1 and TGF-β1) [1–3] and angiogenic factors such as VEGF and its receptors [5]. VEGF (also referred to as VEGF-A) and its receptors (VEGFR1 or Flt-1, VEGFR2 or KDR/Flk-1) are known to be key regulators of angiogenesis/vasculogenesis following injury or ischemia. VEGF is a potent mitogen for endothelial cells, which under various physiological and pathological conditions, elicits an angiogenic [6,7] and anti-apoptotic response in a wide range of in vivo models [8] including MI [9]. VEGF binds with high affinity to tyrosine kinase receptors Flt-1 and KDR, activating distinct signal transduction pathways [8,10]. Among them KDR plays a major role in the VEGF mediated angiogenesis [8]. Previous studies have demonstrated several beneficial effects of VEGF treatment on the ischemic or infarcted heart [9,11,12]. However, the cellular mechanisms are unclear and it is necessary to understand whether or not PPAR-{gamma} agonists induce VEGF production in myoFb, thus promoting the angiogenic mechanisms at the site of MI.

A growing body of evidence clearly indicates that pharmacological activators of closely related nuclear receptors, called peroxisome proliferator-activated receptors (PPARs), are known to inhibit the inflammatory mechanisms and improve the ischemic conditions of the heart [13–17]. PPARs (PPAR-{alpha}, PPAR-β/{delta}, and PPAR-{gamma}) are a ligand-activated superfamily of nuclear transcription factors differentially expressed in most tissues [17]. PPAR-{gamma} is a key regulator of adipogenesis and glucose homeostasis. Ligands of PPAR-{gamma} include prostaglandin derivatives such as 15J2 and glitazones, insulin-sensitizing drugs presently used to treat patients with type-2 diabetes. Among the three different forms of PPARs, studies have well established the non-metabolic role of PPAR-{gamma} in cardioprotective mechanisms in response to various pathological events in the heart [18]. Activation of PPARs by agonists can result in reduction of infarction size (18,19,21), decrease in inflammation [17,19,20], improvement in vasodilation [21], and decrease in left ventricular hypertrophy [22,23]. Additionally, previous studies have suggested that PPAR-{gamma} activators induce heightened expression of VEGF and angiogenesis in both in vitro and in vivo models [24–26]. Accordingly, it was hypothesized that PPAR-{gamma} agonists induce expression of key angiogenic factors such as VEGF and its receptors in myoFb. Such an increase in cardiac myoFb VEGF expression by PPAR-{gamma} activators may initiate the angiogenic response at the site of MI.

Previous in vitro studies using vascular smooth muscle cells as well as macrophages suggest administration of PPAR-{gamma} agonists results in increased VEGF expression, potentially stimulating angiogenesis [24,27]. Our laboratory recently published findings demonstrating expression of VEGF and its receptors [5] by myoFbs isolated from the site of MI, suggesting that the presence of these cells at the site of infarction may play a role in the initiation of the angiogenic process at the site of repair. The present study was designed to investigate whether PPAR-{gamma} agonists promote VEGF and its receptor expression and simultaneously inhibit the inflammatory NF-{kappa}B pathway activity in myoFbs isolated from the site of MI.


    2. Materials and methods
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Statistical analysis
 4. Results
 5. Discussion
 Acknowledgments
 References
 
VEGF, Flt-1 and KDR antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The PPAR-{gamma} agonist Troglitazone (TZ), 15-deoxy-prostaglandin J2 (15J2), and GW 9662 (PPAR-{gamma} antagonist) were acquired from Chemicon (Temecula, CA). Antibodies for PPAR-{gamma} were obtained from Alexis (San Diego, CA). VEGFR tyrosine kinase-inhibitor known as 4-[(4'-chloro-2'-fluoro) phenylamino]-6, 7-dimethoxyquinazoline (Calbiochem, San Diego, CA) was used in this study.

2.1 Dual Labeling of MI heart and myoFb with {alpha}-actin and VEGF or PPAR-{gamma}
MyoFb grown (30% confluent) on cover slips or dissected heart tissue was fixed with 2-4% paraformaldehyde. Tissues were cryoprotected with 30% sucrose in phosphate buffer, and embedded and sectioned 5 µ thick on a cryostat. All antibodies ({alpha}-actin; VEGF, PPAR-{gamma} FITC Donkey Mouse IgG; Rhodamine Red X) were diluted (1:100) and dual labeled according to standard immunofluorescence protocol from Jackson ImmunoResearch Laboratories (West Grove, PA).

2.2 Cell culture
Myocardial infarction was created in 8–12-week-old male Sprague–Dawely (Harlan, IN, USA) rats according to animal use and care guidelines of laboratory animals by National Institutes of Health (NIH Publication No. 85–23, revised 1996) and the institutional animal use and care committee (Brody School of Medicine, East Carolina University) approved animal use protocol. We have established a standard protocol for the isolation and characterization of primary cultures of myoFb from adult rat heart isolated from 28 day post-MI tissues using the previously described method [1–3,5]. Eighty percent grown cells were incubated in low serum (0.4% FBS) DMEM and then cells were pretreated with or without GW 9662 (PPAR-{gamma} antagonist) for 30 min prior to addition of PPAR-{gamma} agonists, TZ (10 µM) or 15J2 (5 µM).

2.3 Western blot
Mouse liver extract (40 µg protein/lane) and protein samples (40 µg/well) were electrophoresed on 4–12% SDS-polyacrylamide gels under reducing conditions. Standard immunoblotting method was used to probe for PPAR-{gamma} [5].

2.4 Flow cytometry
The myoFb (1x106 cells/plate) were treated with PPAR-{gamma} agonists (TZ and 15J2) for 24 h in low serum (0.4% FBS) containing DMEM. Cells were trypsinized and centrifuged at 600 rpm for 5 min at 4 °C and then cell pellets were washed with cold PBS. MyoFb were incubated in growth medium at least 6 h. After incubation myoFb were fixed in PBS containing 2% paraformaldehyde for 10 min at room temperature and subsequently washed with cold PBS three times. The cells were incubated with Flt-1 or KDR (1:100 dilutions) antibody for 1 h on ice and followed by FITC-conjugated affinity-purified anti-rabbit antibody (1:100 dilutions) for 30 min. The cells were analyzed in a FACScan flow cytometer.

2.5 Electrophoresis Mobility Shift Analysis (EMSA)
Myofibroblasts were treated with PPAR-{gamma} agonists (TZ and 15J2) for 3 h and nuclear proteins were isolated using Active Motif nuclear extraction kit. EMSA and NF-{kappa}B activity assays were done according to Promega and Panomics (Panomics NF assay kit; cat # EK1010) recommended protocols.

2.6 In vitro angiogenesis assay
The formation of capillary tube-like structures by human microvascular endothelial cells (HMVEC-d; cc-2543, Clonetics, Walkersville, MD, USA) was analyzed on tumor-derived basement membrane matrix (Matrigel, Discovery labware, Bedford, MA, USA) as per earlier protocols [28]. HMVEC-d cells were trypsinized, resuspended in growth medium, and centrifuged at 400 xg, 10 min, +4 °C. The cells were washed again in 10 ml of DMEM. These cells (1x104) were resuspended in 100 µl of DMEM containing 2% FBS, DMEM containing 2% FBS and 5 ng/ml of VEGF, (R and D Systems, Inc., Minneapolis, MN), or DMEM containing 2% FBS, 5 ng/ml of VEGF, and 50 nM of VEFGR inhibitor (4-[(4'-chloro-2'-fluoro) phenylamino]-6, 7-dimethoxyquinazoline; Calbiochem, San Diego, Calif.) and were seeded into respective Matrigel-coated wells. The test samples included the conditioned medium (CM) obtained from cells that were treated with PPAR-{gamma} agonist. CM refers to medium (DMEM containing 2% FBS) collected 24 h post culturing cells. In another set of experiments, HMVEC-d cells were cultured on a Matrigel in test samples supplemented with 50 nM of VEFGR inhibitor. Finally, to rule out the possibility of the residual effect of PPAR-{gamma} agonists dissolved in CM directly on the tubule formation, we cultured HMVEC-d cells in DMEM containing 2% FBS supplemented with PPAR-{gamma} agonists that were incubated for 24 h in the same incubator from where the test samples were derived. These cells were incubated for 3 h at 37 °C prior to adding the above mentioned test samples. After 16 h incubation at 37 °C, the cells were labeled with calcine AM (Invitrogen) as per the manufacturer's recommendations. Endothelial tubule formation by the cells was observed under an Olympus IMT-2 inverted microscope and tubular structures were scored by counting the number of tubules in each well. The tubules shorter than 100 µm were excluded from the measurement [28].


Table 1 Primers used for PCR

Gene name Gene bank accession no. Primer sequence 5'-3' Product size bp

PPAR {gamma} NM_013124 Forward ACCACGGTTGATTTCTCCAG 241
Reverse GCTTTATCCCCACAGACTCG
β actin NM_031144 Forward AGCCATGTACGTAGCCATCC 230
Reverse CTCTCAGCTGTGGTGGTGAA

2.7 VEGF ELISA
Serum starved sub-confluent myoFbs were pre-treated with TZ (5 µM, 10 µM, 20 µM), 15J2 (2.5 µM, 5 µM, 10 µM), and incubated for different time periods (12 h, 24 h and 48 h) in media which was serum free or contained 2% FBS. MyoFb also treated with 18 µM of NF-{kappa}B peptide inhibitor (CalBiochem USA) or VEGFR inhibitor (50 nM) with and without PPAR -{gamma} agonists for 24 h. Collected media was used in ELISA. The assay was conducted according to manufacturer recommended protocol (Minneapolis, MN, USA).

2.8 cDNA synthesis, PCR and qRT-PCR
Analysis of β-actin mRNA expression by qRT-PCR was performed utilizing a smart cycler real-time PCR (Cepheid, Sunnyvale, CA, USA). RNA isolation, KDR and Flt-1 sequences, analysis method and qRT-PCR conditions were adapted from our previously published methods [5]. cDNA synthesis and PCR was done according to SuperScriptTM II kit and High fidelity PCR amplification kit (Invitrogen, Carlsbad, CA) recommended protocols, respectively.


    3. Statistical analysis
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Statistical analysis
 4. Results
 5. Discussion
 Acknowledgments
 References
 
Results are reported as mean±S.E.M. for a minimum of 3–6 determinations each of which was performed either in duplicate or triplicate. Statistical analysis was performed using one-factor ANOVA, with P<0.05 being considered significant.


    4. Results
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Statistical analysis
 4. Results
 5. Discussion
 Acknowledgments
 References
 
4.1 PPAR-{gamma} expression in myoFb by PCR and Western blot
After 24 h incubation of myoFb in serum deprived medium, total protein and RNA were isolated and analyzed using Western blot and PCR, respectively. Results from both RT-PCR (Fig. 1A) and Western blot (Fig. 1B) demonstrate the expression of PPAR-{gamma} by myoFb isolated from the site of MI. Ten micro molar TZ and 5 µM 15J2 treated myoFb produce highest VEGF after 24 h of incubation (Fig. 1D and E).


Figure 1
View larger version (36K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Expression of PPAR-{gamma} in myoFb by RT-PCR (A) and Western blot (B, lane#1: lysate from myoFb, Lane # 2: liver tissue extract served as positive control for PPAR-{gamma}) (n=5). The specific primers used and respective PCR amplification product sizes for A data are shown in Table 1. PPAR-{gamma} agonists treatment increase the PPAR-{gamma} activity in myoFb (C, n=4 in duplicates). TZ (10 µM) and 15J2 (5 µM) treated myoFb significantly increased the VEGF expression after 24 h of incubation (D (n=4) and E (n=4)). *Represents significant difference between control vs. treatment (*p<0.02) or 12 h VEGF vs 24 h VEGF (*p<0.001). GW represents PPAR-{gamma} antagonist GW9662.

 
4.2 PPAR-{gamma} agonists induce PPAR-{gamma} activity in myoFb
The influence of PPAR-{gamma} agonists (TZ and 15J2) on PPAR-{gamma} activity was determined using PPAR-{gamma} activity assay kit (Panomics, Redwood City, CA). Results clearly indicated that TZ (0.028±0.005) and 15J2 (0.023±0.001) significantly induced PPAR-{gamma} activity when compared to control (0.008±0.002) (Fig. 1C). GW9662 does not completely antagonize the 15J2 or TZ induced PPAR-{gamma} activity even at higher doses (data not shown) in myoFb, suggesting antagonistic properties of GW9662 may be cell specific. This data (Fig. 1C) clearly demonstrate that up-regulation of PPAR-{gamma} activity by these agonists.

4.3 MyoFb express PPAR-{gamma} at site MI and in culture
Dual immuno-labeling of MI heart tissue or myoFb in culture showed positive staining for {alpha}-SMA (positive for myoFb) and VEGF or PPAR-{gamma}  for myoFb at the site of MI and in culture (Fig. 2A, B and C). Whereas, sham operated heart did not show any positive staining for {alpha}-SMA (myoFb) except blood vessels, suggesting that there are no myoFb present in normal heart ventricles. This immunostaining data (for myoFb both at site MI and in culture) further supports our hypothesis that myoFb express PPAR-{gamma} both in vitro and in vivo and plays a key role in repairing/remodeling mechanisms by producing angiogenic factors in response to PPAR-{gamma} agonist treatment.


Figure 2
View larger version (76K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 myoFb ({alpha}-SMA positive cells) at site of MI and in culture express both VEGF and PPAR-{gamma} (n=4).  (A) represents the expression of VEGF (LVMI-VEGF; Sham LV VEGF),   {alpha}-SMA (LVMI {alpha} actin; sham LV actin) and overlay for both sham and LVMI VEGF and {alpha}-SMA. (B) shows the PPAR-{gamma} expression (LVMI PPAR-{gamma}; sham LV PPAR-{gamma}) by myoFb at MI (LVMI {alpha} actin; sham LV {alpha} actin) and co-localization (overlay) of VEGF and PPAR-{gamma} along with {alpha}-SMA. White headed arrows indicate the blood vessels. Co-localization of PPAR-{gamma} or VEGF along with {alpha}-SMA (other than blood vessels) further demonstrates that myoFb at site MI express VEGF and PPAR-{gamma}. (C) Co-localization of VEGF and PPAR-{gamma} along with {alpha}-SMA  demonstrates that myoFb in culture express both VEGF and PPAR-{gamma}. Slides treated either with primary antibody alone or secondary alone or mouse serum sections did not show any positive immunofluorescence (data not shown).

 
4.4 PPAR-{gamma} activation increases mRNA expression of KDR and Flt-1
The qRT-PCR results show TZ and 15J2 elicited an increase in the mRNA expression of KDR (140%±20 and 100%±8.5 respectively) and Flt-1 (110%±10 and 80%±14 respectively) in myoFb when compared to untreated controls (Fig. 3A). The qRT-PCR results also show that PPAR-{gamma} antagonist (GW9662) treatment decreased PPAR-{gamma} agonists induced Flt-1 (TZ: 40.5±10.2; 15J2: 130.2±5.1) and KDR (TZ: 60.1±8.0; 15J2: 40.0±5.0) expression in myoFb (Fig. 3A).


Figure 3
View larger version (30K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 (A) Activation of PPAR-{gamma} by TZ and 15J2 modulate KDR and Flt-1 gene expression in myoFb as measured by real time PCR (control vs. treated *p<0.05) (n=6). The TZ and 15J2 effects were decreased in the presence of a PPAR-{gamma} antagonist GW9662 (KDR: TZ vs TZ+GW, #p<0.01, 15J2 vs 15J2+GW and p<0.001; Flt-1: TZ vs TZ+GW ##p<0.003, 15J2 vs 15J2+GW, and p<0.015). (B) PPAR-{gamma} agonists (TZ and 15J2) treatment increase the expression of KDR and Flt-1 in myoFb. The levels of KDR and Flt-1 expression in myoFb were increased in TZ and 15J2 treated cells as compared to the controls. MyoFb treated with primary antibody alone (Flt-1 or KDR) and secondary alone did show any positive counts (data not shown). Raw numbers (percentage of positive cells) from flowcytometric analysis was used to calculate mean±S.E.M. (control vs. treated *p<0.05, **p<0.001).

 
4.5 PPAR-{gamma} activators induce the expression of KDR and Flt-1
To determine the effects of activation of PPAR-{gamma} on Flt-1 and KDR, cultured myoFb were incubated with PPAR-{gamma} agonists TZ (10 µM) and 15J2 (5 µM). The expression of the cell surface receptors was subsequently measured using flow cytometry. The results (Fig. 3B) show that TZ and 15J2 elicited a significant increase in expression of KDR (14.7±1.0% and 9.6±2.1% respectively) and Flt-1 (24.5±2.0%, and 14.0±2.2% respectively) when compared to untreated controls (4.0±0.31% and 7.6±0.5% for KDR and Flt-1, respectively). Data from four independent experiments (untreated control vs. treated *p<0.001, **p<0.001) showing the effects of TZ and 15J2 on KDR and Flt-1 expression in myoFb, respectively (n=4).

4.6 Activated PPAR-{gamma} increases VEGF
Media from treated myoFbs was subjected to ELISA to measure protein levels of VEGF. Treatment with TZ and 15J2 in media with 2% FBS resulted in a 174.6±22.8 (pg/ml) and 223.1±32.2 (pg/ml) increase in VEGF expression compared to control (94.3±11.2 pg/ml), respectively (Fig. 4A). Specific NF-{kappa}B peptide inhibitor treatment significantly decreased the 20% FBS induced of VEGF expression in myoFb, suggesting that involvement of NF-{kappa}B dependent mechanisms in VEGF expression in myoFb. Surprisingly, NF-{kappa}B treatment along with TZ or 15J2 does not significantly decrease the VEGF expression by TZ (166.6±18.2 pg/ml) or 15J2 (210.6±26.4 pg/ml) in these cells, indicating that PPAR-{gamma} induced VEGF expression is independent of NF-{kappa}B pathway (Fig. 4A). The VEGFR treatment significantly decreased the TZ (117.2±18.9) and 15J2 (140.1±17.1) induced VEGF expression compared 15J2 or TZ in myoFb, suggesting that VEGFR signaling is required for PPAR-{gamma} induced VEGF expression in these cells (Fig. 4B).


Figure 4
View larger version (26K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 PPAR-{gamma} activation by TZ and 15J2 results in increased expression of VEGF as measured by ELISA (A). NF-{kappa}B peptide inhibitor (NF-{kappa}B or NF) does not decrease the TZ and 15J2 induced VEGF expression, whereas 20% FBS induced VEGF expression reduced by NF-{kappa}B inhibitor (A). VEGFR inhibitor decreased TZ and 15J2 induced VEGF expression (B) (*p<0.05 TZ, 15J2 vs. untreated control or NF {kappa}B vs TZ, 15J2, 20%FBS; TZ vs TZ+VEGFR; 15J2 vs 15J2+VEGFR; VEGFR vs TZ or 15J2, n=3–4 in triplicates).

 
4.7 PPAR-{gamma} agonists induced angiogenesis
We tested the ability of the conditioned medium obtained from myoFbs treated with PPAR-{gamma} agonists (TZ and 15J2) to mediate tubule formation on a Matrigel as per earlier protocols [28]. HMVEC-d cells cultured on a Matrigel using CM obtained from myoFbs treated with PPAR-{gamma} agonist (TZ and 15J2, respectively) significantly induced angiogenic tubule formation (Fig. 5C and D). Similar results were obtained when cells were grown in DMEM containing 2% FBS and VEGF (Fig. 5B). On the contrary, angiogenic tubule formation was less pronounced in cells that were grown in DMEM containing just 2% FBS (Fig. 5A). Also, culturing cells directly in DMEM containing 2% FBS and supplemented with either TZ or 15J2 did not significantly alter the ability to form tubules suggesting a specific role for the agonist-induced VEGF in the CM for the angiogenesis (Fig. 5G). Interestingly, VEGFR inhibitor treated-HMVEC-d cells cultured using CM obtained from TZ and 15J2 treated myoFb supported a significantly lesser number of tubules/well (Fig. 5E and F). Identical results were observed when VEGFR inhibitor treated cells were grown in either DMEM containing 2% FBS and VEGF, or CM (Fig. 5G). DMSO, the vehicle for the VEGFR inhibitor did not alter the ability of HMVEC-d cells to support tubule formation, suggesting the specificity of the inhibitor (data not shown). Overall, our results suggest a role for the PPAR-{gamma} agonists-induced VEGF to mediate angiogenesis in these cells.


Figure 5
View larger version (61K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Tubule formation as measured by in vitro angiogenesis assay with the CM collected from myoFb that were untreated (A); treated with rVEGF (B), TZ (C) or 15J2 (D). Representative pictures of the effect of VEGFR-inhibitor treated HMVEC-d cells that were incubated with CM obtained from myoFb treated with TZ (E) or 15J2 (F) is also shown. Graph (G) shows the number of tubules formed by HMVEC-d cells on a Matrigel when cultured under different conditions. The cells were either left alone or incubated with VEGFR-inhibitor along with CM obtained from myoFbs treated with different PPAR-{gamma} agonists (white bars). For control experiments, cells were either left alone or incubated with VEGFR-inhibitor along with DMEM containing 2% FBS, DMEM containing 2% FBS+VEGF, or DMEM containing 2% FBS+PPAR-{gamma} agonists (shaded bars). Data presented represent the average±SD of six experiments. Columns with Asterisk mark indicate the values to be statistically significant (P<0.05) by least significant difference (LSD).

 
4.8 Regulation of NF-{kappa}B activity by PPAR-{gamma}
We analyzed the NF-{kappa}B activity in TZ and 15J2 treated myoFb nuclear protein using EMSA. EMSA results demonstrate decreased activity of NF-{kappa}B resulting from treatment with 15J2 (Fig. 6A). Similar results were found when NF-{kappa}B activity was measured with ELISA kit (Fig. 6B). The decrease in the levels of inflammatory cytokines, pro-remodeling cytokines or NF-{kappa}B activity has been shown to have a beneficial effect on ischemic/infarcted heart.


Figure 6
View larger version (26K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 NF-{kappa}B activity as measured by EMSA in nuclear protein isolated from myoFb treated with TZ (lane #4), 15J2 (lane #5), control (lane # 3), positive control (lane #6), competition with a molar excess of unlabeled probe (Lane # 1 and 2) and free probe without protein (lane # 7, A). NS represents non-specific binding. (B) shows NF-{kappa}B activity using ELISA (control vs. 15J2 or NF {kappa}B inhibitor *p<0.05 (n=3)).

 

    5. Discussion
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Statistical analysis
 4. Results
 5. Discussion
 Acknowledgments
 References
 
Troglitazone (TZ) and 15J2 are identified as ligands for PPAR-{gamma} and are known to activate the PPAR-{gamma} mediated signaling mechanisms. Emerging evidence clearly indicates that the PPAR-{gamma} regulatory pathways play a critical role in the regulation of a variety of biological processes within the cardiovascular system. Several reports have demonstrated the beneficial role of PPAR-{gamma} agonists in myocardial ischemia-reperfusion injury of the heart and hypertrophy [14,18,22]. PPAR-{gamma} agonists have been shown to suppress the expression of pro-inflammatory cytokines (TNF-{alpha}, IL-1ß, TGF-β1, MMP-9 etc.) and improve the left ventricular function in myocardial infarction. Previous studies have demonstrated that VEGF treatment or abrogation of NF-{kappa}B pathway protects the heart from ischemic injury/inflammation or MI. Although cardiac myoFbs are known to play a major role in repair/wound healing mechanisms following ischemic injury/MI [19], nothing is known about their role in PPAR-{gamma} agonist mediated cellular mechanisms. We were particularly interested in understanding the effect of PPAR-{gamma} agonists on the expression of VEGF, its receptors, and the inflammatory NF-{kappa}B pathway activity in myoFb.

As stated above, myoFb are wound-healing cells found at the site of injury and have phenotypic characteristics of both smooth muscle cells as well as fibroblasts [1,2,30,31]. Our recent report also suggests that these cells may play a potential role in angiogenesis due to their ability to express VEGF [5]. VEGF is activated in response to various physiological and pathological conditions [8,32]. PPARs have recently received increased attention with regard to cardioprotective mechanisms by modulating such pathologic entities as hypertrophy, apoptosis, and inflammation [13,14,16,19,20,22,23,33]. However, the role of PPARs in angiogenesis has yet to be fully elucidated. Our results suggest that the activation of PPAR-{gamma} by its agonists in the cultured myoFb will induce the expression of proangiogenic mediators, such as VEGF and its receptors Flt-1 and KDR.

The first objective of this study was to determine the effects of PPAR-{gamma} agonists TZ and 15J2 on expression of Flt-1 and KDR in myoFb. As determined by flow cytometry, myoFb incubated with TZ and 15J2 resulted in significant increases in Flt-1 and KDR. Our results corroborate those of Cho et al. who found 12 h incubation of TZ with aortic endothelial cells resulted in increased expression of VEGF and KDR [24]. However, our results directly conflict with those found by Xin et al. in human umbilical vein endothelial cells (HUVECs) [34]. The investigators found that activation of PPAR-{gamma} using 15J2 resulted in decreased expression of both KDR and Flt-1. Recently, Meissner et al. [35] reported that it was PPAR-{alpha} but not PPAR-{gamma} agonists that inhibit the in vitro angiogenesis in HUVECs by decreasing KDR expression mechanisms. Even though Xin et al. [34] and Meissner et al. [35] employed similar type of cells (i.e., HUVEC), the results were contradictory. The reason for this kind of discrepancy in the literature on PPAR-{gamma} agonists-induced expression of VEGF and its receptors could be due to variation in the experimental design, cell number and passage, and experimental conditions used in these studies. Hence, further research on the regulatory mechanisms of PPAR-{gamma} on VEGF and its receptor is needed.

The second aim of this study was to ascertain the physiological relevance of PPAR-{gamma} activation on the expression of VEGF in myoFb. Activation of PPAR-{gamma} by TZ and 15J2 significantly increased the myoFb expression of VEGF, as measured ELISA, and in vitro angiogenesis assay. VEGFR inhibitor treatment along with PPAR-{gamma} agonists significantly decreased the VEGF expression in myoFb, suggesting that PPAR-{gamma} agonists' induced VEGFR expression may be required for VEGF expression in myoFb. However, further studies are required to understand how VEGFR is involved in VEGF expression in these cells.

It is currently unclear as to the mechanism by which PPAR-{gamma} activation leads to increases in VEGF and KDR up-regulation. Cho et al. [24] suggested the up-regulation may be due to PPAR-{gamma} activating additional transcription factors as opposed to direct PPAR-{gamma} binding to the VEGF promoter, since it contains no PRE (promoter response element). NF-{kappa}B is a major inflammatory mediator and is activated in response to TNF, IL-1, LPS, virus, and UV and {gamma} radiation [29]. In turn NF-{kappa}B signaling induces VEGF up-regulation [36–38]. Because NF-{kappa}B participates in inflammatory pathways mediated by VEGF, the current study analyzed the role of NF {kappa}B in PPAR-{gamma} induced VEGF expression. Interestingly, our data suggests that VEGF expression by PPAR-{gamma} agonists is independent of NF-{kappa}B signaling in myoFb. This further supports our hypothesis that activation of PPAR-{gamma} using agonists in myoFb at the site of MI may decrease inflammatory mechanisms and initiate angiogenic response in surrounding endothelial cells by increasing the expression of VEGF. TZ and 15J2 are known to antagonize the inflammatory mechanisms in similar fashion. However, in this study, we found 15J2 (and not TZ) to inhibit NF-{kappa}B activity. This may be due to the inability of TZ to inhibit I{kappa}B kinase activity (I{kappa}B is essential for NF-{kappa}B activity). Similarly, Masamune et al. [39] also found 15J2 to inhibit NF-{kappa}B activity but not TZ. Such differences between the synthetic (TZ) and natural ligands (15J2) are said to exist [40].

In conclusion, the present study demonstrates for the first time, the ability of PPAR-{gamma} agonists to increase the expression of pro-angiogenic factors (VEGF and its receptors) while inhibiting the inflammatory pathway NF-{kappa}B activity in myoFb. These in vitro observations clearly suggest that PPAR-{gamma} agonists induce VEGF expression in myoFb and may be participating in the repair/neovascualarization mechanisms at the site of MI. These findings are useful for further, understanding of the beneficial effects of PPAR-{gamma} in myoFb mediated cardiac tissue repair following MI and inflammatory conditions of the heart.


    Acknowledgments
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Statistical analysis
 4. Results
 5. Discussion
 Acknowledgments
 References
 
This work was partly supported by National Institute of Health grant, HL-R01-60047 and East Carolina University faculty development grant awarded to LCK, American Heart Association grant 0225555U award to VC, and a grant from the American Cancer Society (IRG-97-149) to SMA. The authors wish to thank Jessica Dries and Marshall Nichols for critical reading of this manuscript.


    Notes
 
Time primary review 28 days


    References
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Statistical analysis
 4. Results
 5. Discussion
 Acknowledgments
 References
 

  1. Campbell S.E., Katwa L.C. Angiotensin II stimulated expression of transforming growth factor-beta1 in cardiac fibroblasts and myofibroblasts. J Mol Cell Cardiol (1997) 29:1947–1958.[CrossRef][Web of Science][Medline]
  2. Katwa L.C. Cardiac myofibroblasts isolated from the site of myocardial infarction express endothelin de novo. Am J Physiol Heart Circ Physiol (2003) 285:H1132–H1139.[Abstract/Free Full Text]
  3. Katwa L.C., Campbell S.E., Tyagi S.C., Lee S.J., Cicila G.T., Weber K.T. Cultured myofibroblasts generate angiotensin peptides de novo. J Mol Cell Cardiol (1997) 29(5):1375–1386.[CrossRef][Web of Science][Medline]
  4. Weber K.T., Sun Y., Katwa L.C. Myofibroblasts and local angiotensin II in rat cardiac tissue repair. Int J Biochem Cell Biol (1997) 29:31–42.[CrossRef][Web of Science][Medline]
  5. Chintalgattu V., Nair D.M., Katwa L.C. Cardiac myofibroblasts: a novel source of vascular endothelial growth factor (VEGF) and its receptors Flt-1 and KDR. J Mol Cell Cardiol (2003) 35:277–286.[CrossRef][Web of Science][Medline]
  6. Friehs I., Moran A.M., Stamm C., Choi Y.-H., Cowan D.B., McGowan F.X., et al. Promoting angiogenesis protects severely hypertrophied hearts from ischemic injury. Ann Thorac Surg (2004) 77:2004–2010.[Abstract/Free Full Text]
  7. Rafiee P., Heidemann J., Ogawa H., Johnson N., Fisher P., Li M., et al. Cyclosporin A differentially inhibits multiple steps in VEGF induced angiogenesis in human microvascular endothelial cells through altered intracellular signaling. Cell Commun Signal (2004) 2:1–22.[CrossRef][Medline]
  8. Ferrara N. Role of vascular endothelial growth factor in regulation of physiological angiogenesis. Am J Physiol Cell Physiol (2001) 280:C1358–C1366.[Abstract/Free Full Text]
  9. Yang Y., Min J.Y., Rana J.S., Ke Q., Cai J., Chen Y., et al. VEGF enhances functional improvement of postinfarcted hearts by transplantation of ESC-differentiated cells. J Appl Physiol (2002) 93:1140–1151.[Abstract/Free Full Text]
  10. Waltenberger J., Claesson-Welsh L., Siegbahn A., Shibuya M., Heldin C. Different signal transduction properties of KDR and Flt1, two receptors for vascular endothelial growth factor. J Biol Chem (1994) 269:26988–26995.[Abstract/Free Full Text]
  11. Symes J.F., Losordo D.W., Vale P.R., Lathi K.G., Esakof D.D., Mayskiy M., et al. Gene therapy with vascular endothelial growth factor for inoperable coronary artery disease. Ann Thorac Surg (1999) 68:830–836.[Abstract/Free Full Text]
  12. Yoon Y.S., Johnson I.A., Park J.S., Diaz L., Losordo D.W. Therapeutic myocardial angiogenesis with vascular endothelial growth factors. Mol Cell Biochem (2004) 264:63–64.[CrossRef][Web of Science][Medline]
  13. Delerive P., Fruchart J.C., Staels B. Peroxisome proliferator-activated receptors in inflammation control. J Endocrinol (2001) 169:453–459.[Abstract]
  14. Ito H., Nakano A., Kinoshita M., Matsumori A. Pioglitazone, a peroxisome proliferator-activated receptor-gamma agonist, attenuates myocardial ischemia/reperfusion injury in a rat model. Lab Invest (2003) 83:1715–1721.[CrossRef][Web of Science][Medline]
  15. Khandoudi N., Delerive P., Berrebi-Bertrand I., Buckingham R.E., Staels B., Bril A. Rosiglitazone, a peroxisome proliferator-activated receptor-gamma, inhibits the Jun NH(2)-terminal kinase/activating protein 1 pathway and protects the heart from ischemia/reperfusion injury. Diabetes (2002) 51:1507–1514.[Abstract/Free Full Text]
  16. Liu H.R., Tao L., Gao E., Lopez B.L., Christopher T.A., Willette R.N., et al. Anti-apoptotic effects of rosiglitazone in hypercholesterolemic rabbits subjected to myocardial ischemia and reperfusion. Cardiovasc Res (2004) 62:135–144.[Abstract/Free Full Text]
  17. Wayman N.S., Hattori Y., McDonald M.C., Mota-Filipe H., Cuzzocrea S., et al. Ligands of the peroxisome proliferator-activated receptors (PPAR-gamma and PPAR-alpha) reduce myocardial infarct size. FASEB J (2002) 16:1027–1040.[Abstract/Free Full Text]
  18. Abdelrahman M., Sivarajah A., Thiemermann C. Beneficial effects of PPAR-gamma ligands in ischemia-reperfusion injury, inflammation and shock. Cardiovasc Res (2005) 65:772–781.[Abstract/Free Full Text]
  19. Cernuda-Morollon E., Rodriguez-Pascual F., Klatt P., Lamas S., Perez-Sala D. PPAR agonists amplify iNOS expression while inhibiting NF-kappaB: implications for mesangial cell activation by cytokines. J Am Soc Nephrol (2002) 13:2223–2231.[Abstract/Free Full Text]
  20. Diep Q.N., Benkirane K., Amiri F., Cohn J.S., Endemann D., Schiffrin E.L. PPAR[alpha] activator fenofibrate inhibits myocardial inflammation and fibrosis in angiotensin II-infused rats. J Mol Cell Cardiol (2004) 36:295–304.[CrossRef][Web of Science][Medline]
  21. Tabernero A., Schoonjans K., Jesel L., Carpusca I., Auwerx J., Andriantsitohaina R. Activation of the peroxisome proliferator-activated receptor alpha protects against myocardial ischaemic injury and improves endothelial vasodilatation. BMC Pharmacol (2002) 2:10.[CrossRef][Medline]
  22. Asakawa M., Takano H., Nagai T., Uozumi H., Hasegawa H., Kubota N., et al. Peroxisome proliferator-activated receptor gamma plays a critical role in inhibition of cardiac hypertrophy in vitro and in vivo. Circulation (2002) 105:1240–1246.[Abstract/Free Full Text]
  23. Sakai S., Miyauchi T., Irukayama-Tomobe Y., Ogata T., Goto K., Yamaguchi I. Peroxisome proliferator-activated receptor-gamma activators inhibit endothelin-1-related cardiac hypertrophy in rats. Clin Sci (Lond) (2002) 103(48):16S–20S. [Suppl].[Medline]
  24. Cho D.H., Choi Y.J., Jo S.A., Jo I. Nitric oxide production and regulation of endothelial nitric-oxide synthase phosphorylation by prolonged treatment with troglitazone: evidence for involvement of peroxisome proliferator-activated receptor (PPAR) gamma-dependent and PPARgamma-independent signaling pathways. J Biol Chem (2004) 279:2499–2506.[Abstract/Free Full Text]
  25. Pola R., Gaetani E., Flex A., Aprahamian T.R., Bosch-Marce M., Losordo D.W., et al. Comparative analysis of the in vivo angiogenic properties of stable prostacyclin analogs: a possible role for peroxisome proliferator-activated receptors. J Mol Cell Cardiol (2004) 36:363–370.[CrossRef][Web of Science][Medline]
  26. Yamakawa K., Hosoi M., Koyama H., Tanaka S., Fukumoto S., Morii H., et al. Peroxisome proliferator-activated receptor-gamma agonists increase vascular endothelial growth factor expression in human vascular smooth muscle cells. Biochem Biophys Res Commun (2000) 271:571–574.[CrossRef][Web of Science][Medline]
  27. Jozkowicz A., Dulak J., Piatkowska E., Placha W., Dembinska-Kiec A. Ligands of peroxisome proliferator-activated receptor-gamma increase the generation of vascular endothelial growth factor in vascular smooth muscle cells and in macrophages. Acta Biochim Pol (2000) 47:1147–1157.[Web of Science][Medline]
  28. Akula S.M., Ford P.W., Whitman A.G., Hamden K.E., Bryan B.A., Cook P.P., et al. B-Raf dependent expression of vascular endothelial growth factor-A in Kaposi's sarcoma-associated herpesvirus infected human B cells. Blood (2005) 105(11):4516–4522.[Abstract/Free Full Text]
  29. Muller J.M., Rupec R.A., Baeuerle P.A. Study of gene regulation by NF-[kappa]B and AP-1 in response to reactive oxygen intermediates. Methods (1997) 11:301–312.[CrossRef][Web of Science][Medline]
  30. Phan S.H. The Myofibroblast in Pulmonary Fibrosis. Chest (2002) 122:286S–289S.[CrossRef][Web of Science][Medline]
  31. Yang J., Liu Y. Blockage of tubular epithelial to myofibroblast transition by hepatocyte growth factor prevents renal interstitial fibrosis. J Am Soc Nephrol (2002) 13:96–107.[Abstract/Free Full Text]
  32. Ruhrberg C. Growing and shaping the vascular tree: multiple roles for VEGF. Bioessays (2003) 25:1052–1060.[CrossRef][Web of Science][Medline]
  33. Straus D.S., Pascual G., Li M., Welch J.S., Ricote M., Hsiang C.H., et al. 15-deoxy-delta 12, 14-prostaglandin J2 inhibits multiple steps in the NF-kappa B signaling pathway. Proc Natl Acad Sci U S A (2000) 97:4844–4849.[Abstract/Free Full Text]
  34. Xin X., Yang S., Kowalski J., Gerritsen M.E. Peroxisome proliferator-activated receptor gamma ligands are potent inhibitors of angiogenesis in vitro and in vivo. J Biol Chem (1999) 274:9116–9121.[Abstract/Free Full Text]
  35. Meissner M., Stein M., Urbich C., Reisinger K., Suske G., Staels B., et al. PPAR alpha activators inhibit vascular endothelial growth factor receptor-2 expression by repressing Sp1-dependent DNA binding and transactivation. Circ Res (2004) 94:324–332.[Abstract/Free Full Text]
  36. Josko J., Mazurek M. Transcription factors having impact on vascular endothelial growth factor (VEGF) gene expression in angiogenesis. Med Sci Monit (2004) 10:RA89–RA98.[Web of Science][Medline]
  37. Kim I., Moon S.O., Kim S.H., Kim H.J., Koh Y.S., Koh G.Y. Vascular endothelial growth factor expression of intercellular adhesion molecule 1 (ICAM-1), vascular cell adhesion molecule 1 (VCAM-1), and E-selectin through nuclear factor-kappa B activation in endothelial cells. J Biol Chem (2001) 276:7614–7620.[Abstract/Free Full Text]
  38. Ko H.M., Jung H.H., Seo K.H., Kang Y.R., Kim H.A., Park S.J., et al. Platelet-activating factor-induced NF-kappaB activation enhances VEGF expression through a decrease in p53 activity. FEBS Lett (2006) 580:3006–3012.[CrossRef][Web of Science][Medline]
  39. Masamune A., Kikuta K., Satoh M., Sakai Y., Satoh A., Shimosegawa T. Ligands of peroxisome proliferator-activated receptor-gamma block activation of pancreatic stellate cells. J Biol Chem (2002) 277:141–147.[Abstract/Free Full Text]
  40. Sarraf P., Mueller E., Smith W.M., Wright H.M., Kum J.B., Aaltonen L.A., et al. Loss-of-function mutations in PPAR gamma associated with human colon cancer. Mol Cell (1999) 3:799–804.[CrossRef][Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Cancer Res.Home page
L. Tian, J. Zhou, M. C. Casimiro, B. Liang, J. O. Ojeifo, M. Wang, T. Hyslop, C. Wang, and R. G. Pestell
Activating Peroxisome Proliferator-Activated Receptor {gamma} Mutant Promotes Tumor Growth In vivo by Enhancing Angiogenesis
Cancer Res., December 15, 2009; 69(24): 9236 - 9244.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
L. Piqueras, M. J. Sanz, M. Perretti, E. Morcillo, L. Norling, J. A. Mitchell, Y. Li, and D. Bishop-Bailey
Activation of PPAR{beta}/{delta} inhibits leukocyte recruitment, cell adhesion molecule expression, and chemokine release
J. Leukoc. Biol., July 1, 2009; 86(1): 115 - 122.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
D. Schiefelbein, O. Seitz, I. Goren, J. P. Dissmann, H. Schmidt, M. Bachmann, R. Sader, G. Geisslinger, J. Pfeilschifter, and S. Frank
Keratinocyte-Derived Vascular Endothelial Growth Factor Biosynthesis Represents a Pleiotropic Side Effect of Peroxisome Proliferator-Activated Receptor-{gamma} Agonist Troglitazone but Not Rosiglitazone and Involves Activation of p38 Mitogen-Activated Protein Kinase: Implications for Diabetes-Impaired Skin Repair
Mol. Pharmacol., October 1, 2008; 74(4): 952 - 963.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
F. Biscetti, E. Gaetani, A. Flex, T. Aprahamian, T. Hopkins, G. Straface, G. Pecorini, E. Stigliano, R. C. Smith, F. Angelini, et al.
Selective Activation of Peroxisome Proliferator-Activated Receptor (PPAR){alpha} and PPAR{gamma} Induces Neoangiogenesis Through a Vascular Endothelial Growth Factor-Dependent Mechanism
Diabetes, May 1, 2008; 57(5): 1394 - 1404.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
N. Mochizuki and Y.-G. Kwon
15-Lipoxygenase-1 in the Vasculature: Expanding Roles in Angiogenesis
Circ. Res., February 1, 2008; 102(2): 143 - 145.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Chintalgattu, V.
Right arrow Articles by Katwa, L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chintalgattu, V.
Right arrow Articles by Katwa, L. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?